version
PlantPromoterDB promoter information of J065075B09

Summary of Gene (J065075B09)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0251800        NCBI 
Gene model J065075B09  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 4514768-4515967)

Genome position     
from initiation codon
006-100-E12         
AK061218            
AK104010            
J065048A02          
J065073P10          
J065112B05          
J090014H10          
TSS from cDNA
TSS information
J065075B09                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065075B09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4515571-197
TSS clone peakAclone+4515586-182

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCCC+45155404515550-228-218
Y PatchCTCTCTCTCTCCC+45155734515585-195-183
Y PatchCCCTTCTCCCCC+45155954515606-173-162
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGAGCCG+45153534515360-415-408
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGCCGATCCG+45153804515387-388-381
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGGCCCCACG+45153924515399-376-369
 OsREG572GCCCCACG PPDB Motif  PLACE Motif 
REGCGCGACGCGACGC+45154084515420-360-348
 OsREG556CGCGACGCGACGC PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG     PPDB Motif  PLACE MotifCGACG 
 OsREG583   GACGCGAC   PPDB Motif  PLACE Motif 
REGCGCACCGC+45154604515467-308-301
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGAGCCCATGGCCCATGG+45154814515496-287-272
 OsREG467AGCCCATG         PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525 GCCCATGGCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG487     ATGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488      TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517       GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCGTGTGGGCCCCACC+45155034515517-265-251
 OsREG526CGTGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627  TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612       GCCCCACC PPDB Motif  PLACE Motif 
REGACCCCCCA+45155324515539-236-229
 OsREG438ACCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.