version
PlantPromoterDB promoter information of J065078N12

Summary of Gene (J065078N12)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0366100        NCBI 
Gene model J065078N12  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 17068190-17069389)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J065078N12                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065078N12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+17070284-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCCCTCA+1707000817070015-382-375
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGGGTCCCACC+1707018117070189-209-201
 OsREG650GGTCCCAC  PPDB MotifGGGACCC  PLACE Motif 
 OsREG651 GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGAGGTGGGCCCCACCTGTCAG+1707020617070225-184-165
 OsREG476AGGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436         CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501          CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551            CCTGTCAG PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.