version
PlantPromoterDB promoter information of J065082K22

Summary of Gene (J065082K22)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0291100        NCBI 
Gene model J065082K22  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 11260715-11261914)

Genome position     
from initiation codon
013-021-D10         
013-038-B12         
AK068555            
AY445627            
D00644              
J013156H12          
J023122F15          
J065001F13          
J065001O16          
J065006D15          
J065008I17          
J065008N22          
J065010K05          
J065015G11          
J065020N17          
J065024O18          
J065025A04          
J065026I06          
J065028C06          
J065029C01          
J065029C06          
J065029D16          
J065029E02          
J065030P11          
J065032M13          
J065037H24          
J065037O14          
J065038A12          
J065043A05          
J065046C06          
J065046D22          
J065048C14          
J065048D24          
J065049F19          
J065050C04          
J065052J16          
J065055E07          
J065055I04          
J065060L04          
J065062I15          
J065062J11          
J065065I12          
J065068C24          
J065069M04          
J065071J22          
J065076A12          
J065076C24          
J065076F09          
J065076F16          
J065077O06          
J065081E14          
J065082L04          
J065085B02          
J065089C21          
J065092L07          
J065093G08          
J065093I19          
J065093K24          
J065093N04          
J065094I09          
J065094N19          
J065095J17          
J065095N24          
J065096B17          
J065096C02          
J065097P18          
J065099E07          
J065103D23          
J065104F04          
J065104L17          
J065111L14          
J065112K11          
J065115P09          
J065123A02          
J065127P14          
J065137E16          
J065138H20          
J065138J11          
J065141K23          
J065141L14          
J065143P04          
J065146N12          
J065147F21          
J065147N15          
J065154L06          
J065156C09          
J065156J18          
J065157C19          
J065159H23          
J065159M08          
J065163B19          
J065164K14          
J065166K07          
J065166O07          
J065168A18          
J065170B18          
J065170D18          
J065173E05          
J065174L23          
J065177F08          
J065177I05          
J065178P20          
J065181G24          
J065182A07          
J065183D24          
J065184K10          
J065185P10          
J065186J16          
J065188K23          
J065190E22          
J065191D06          
J065193C05          
J065193N13          
J065194B15          
J065199C03          
J065200P19          
J065202O18          
J065203F16          
J065204A15          
J065206P13          
J065207P12          
J065210J24          
J065211K01          
J065213O21          
J065215L18          
J065216N22          
J065219A16          
J065219C24          
J075012P04          
J075013K19          
J075028P16          
J075032H22          
J075032J18          
J075042O14          
J075047A04          
J075053A16          
J075064C23          
J075072H11          
J075073C03          
J075081G11          
J075093H04          
J075095A11          
J075095C13          
J075100D18          
J075101P08          
J075118D19          
J075122K13          
J075125G22          
J075129E22          
J075129I07          
J075132C12          
J075135E24          
J075136I06          
J075136O07          
J075138I07          
J075142G08          
J075147J22          
J075150H20          
J075151A15          
J075151G24          
J075151J20          
J075156N21          
J075158O12          
J075161E05          
J075166F17          
J075169M10          
J075174K15          
J075185G15          
J075188P12          
J075191P15          
J075197E23          
J075197M02          
J075198M16          
J080020B11          
J080021M20          
J080066K02          
J080301F01          
J080301G19          
J080305G02          
J080306N09          
J080309D21          
J080309I02          
J080313J11          
J080313P09          
J080315B10          
J080315O13          
J080316G02          
J080317F03          
J080318D17          
J080319C10          
J090017E03          
J090034N22          
J090042G07          
J090062P21          
J090082D08          
J090096M13          
J100086J22          
TSS from cDNA
TSS information
J065082K22                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065082K22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+11261645-70
TSS clone peakAclone+11261648-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATATAAGC+1126161211261620-103-95
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCATCC+1126142611261433-289-282
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGGGTCCAGA+1126144311261450-272-265
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 
REGCGACACGTGGC+1126147411261484-241-231
 OsREG452CGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGATGGGCCTG+1126149311261503-222-212
 OsREG607TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.