version
PlantPromoterDB promoter information of J065083J02

Summary of Gene (J065083J02)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0533500        NCBI 
Gene model J065083J02  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 21401575-21400376)

Genome position     
from initiation codon
J065106H15          
J065194D13          
TSS from cDNA
TSS information
J065083J02                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065083J02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-21399147-22

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGCCCATCCACCCACTTG-2139919421399214-69-89
 OsREG440ACCGGCCC              PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG608    GCCCATCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG534     CCCATCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG515       CATCCACC       PPDB Motif  PLACE Motif 
 OsREG498             CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCGGCCCGGCCCAGA-2139921921399238-94-113
 OsREG568TCGGCCCG             PPDB MotifACGGGC  PLACE Motif 
 OsREG544 CGGCCCGGCCCGG       PPDB Motif  PLACE Motif 
 OsREG616  GGCCCGGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614   GCCCGGCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538    CCCGGCCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542          CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565           CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629            GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGGGCTGGGCCGCGTGGGCCAA-2139924321399263-118-138
 OsREG533GGGCTGGG              PPDB MotifGCCCA  PLACE Motif 
 OsREG603 GGCTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GCTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG565   CTGGGCCG           PPDB MotifGCCCA  PLACE Motif 
 OsREG618    TGGGCCGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG530         CGCGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG602          GCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571           CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654            GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660             TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAGCCGTTG-2139927921399286-154-161
 OsREG469AGCCGTTG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.