version
PlantPromoterDB promoter information of J065083P21

Summary of Gene (J065083P21)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0632000        NCBI 
Gene model J065083P21  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 27285799-27286998)

Genome position     
from initiation codon
AF010580            
AJ002893            
J065001J09          
J065002D04          
J065041I19          
J065051I02          
J065054G12          
J065061A03          
J065061B03          
J065062D24          
J065079O14          
J065098H21          
J065101F01          
J065102M05          
J065121E24          
J065138P03          
J065161B22          
J065163E13          
J065165D14          
J065169J17          
J065191B15          
J065197C23          
J075002C02          
J075003D03          
J075003M01          
J075011J11          
J075013I09          
J075013P21          
J075020D15          
J075020L10          
J075025P14          
J075031G13          
J075044J01          
J075048K03          
J075081H02          
J075081M24          
J075093H13          
J075096I02          
J075096K17          
J075097I08          
J075097L19          
J075098K03          
J075099L15          
J075118E23          
J075118H23          
J075118J24          
J075127N03          
J075142H14          
J075146D17          
J075156K21          
J080016A22          
J080040H01          
J080068A22          
J080068G23          
J080072C22          
J080092L23          
J080094M23          
J080094P05          
J080304H19          
J090045K01          
J090051E23          
J090084I02          
J100024B13          
J100024H16          
J100025F08          
J100026C20          
J100026J20          
J100026J24          
J100026K14          
J100026M15          
J100027A21          
J100027C08          
J100027D04          
J100027F17          
J100027G08          
J100027H22          
J100027N15          
J100028F01          
J100028J11          
J100029B19          
J100029C17          
J100029K13          
J100029N17          
J100030A16          
J100030F13          
J100030M17          
J100030N04          
J100030N09          
J100031F16          
J100031I07          
J100031K06          
J100031K09          
J100032E01          
J100032F13          
J100032I20          
J100032N21          
J100032O06          
J100033E08          
J100033M19          
J100033M22          
J100034B22          
J100034H08          
J100034K22          
J100034N04          
J100034P17          
J100035K22          
J100035L11          
J100035N24          
J100036L18          
J100037B01          
J100037F04          
J100037H23          
J100037L18          
J100038B05          
J100038F13          
J100038K04          
J100039G20          
J100040G09          
J100041A11          
J100041B22          
J100041K06          
J100041O09          
J100042A20          
J100042C07          
J100042I02          
J100042K03          
J100043C18          
J100043D20          
J100043F08          
J100043G23          
J100043H22          
J100043I23          
J100043K11          
J100043P03          
J100044C01          
J100044F02          
J100044L10          
J100045A13          
J100045D16          
J100045D23          
J100045F09          
J100045H22          
J100045O07          
J100046J15          
J100046K14          
J100046L15          
J100047L23          
J100047P05          
J100048A20          
J100048C22          
J100048G17          
J100048J20          
J100048K18          
J100048L22          
J100048O22          
J100049F18          
J100049M03          
J100050C20          
J100050G14          
J100050O10          
J100051E09          
J100051F20          
J100051I22          
J100051J11          
J100051J17          
J100052A04          
J100052E01          
J100052E13          
J100054A10          
J100054B08          
J100054B12          
J100054F05          
J100054I16          
J100054L18          
J100055A03          
J100055K11          
J100056I06          
J100056I16          
J100056M20          
J100057D04          
J100057E15          
J100057G07          
J100057H22          
J100058H07          
J100058M11          
J100058M20          
J100058N04          
J100058N16          
J100058O11          
J100059A20          
J100059E05          
J100059K17          
J100059M07          
J100060A07          
J100060G24          
J100060I15          
J100060M15          
J100060M20          
J100060N23          
J100061H20          
J100062C04          
J100062C22          
J100062F20          
J100062G08          
J100062H17          
J100062I05          
J100062L21          
J100062O04          
J100063B10          
J100063C01          
J100063D11          
J100064B18          
J100064G01          
J100064K07          
J100064L09          
J100064M13          
J100064O10          
J100065J24          
J100065N15          
J100066E13          
J100066G16          
J100066J03          
J100066K06          
J100066P15          
J100067D12          
J100067G04          
J100067G18          
J100067I18          
J100067K04          
J100068C21          
J100068D08          
J100068G17          
J100068H09          
J100069F05          
J100069I20          
J100069J05          
J100070D16          
J100070I09          
J100070K06          
J100071G09          
J100071H20          
J100071K07          
J100071L03          
J100071L13          
J100072A11          
J100072C19          
J100072E13          
J100072E16          
J100072M06          
J100072O10          
J100073E05          
J100073L14          
J100073N05          
J100074I04          
J100074K21          
J100074L22          
J100074N07          
J100075F18          
J100075H14          
J100075I03          
J100075K02          
J100075K11          
J100075K16          
J100075N08          
J100076A03          
J100076C05          
J100076I24          
J100077H07          
J100077P09          
J100078C15          
J100078J15          
J100078K02          
J100078K23          
J100078M11          
J100079E21          
J100079F03          
J100079K13          
J100081L17          
J100081P09          
J100082D14          
J100083E07          
J100083H07          
J100084B12          
J100084C20          
J100084D21          
J100084L21          
J100085I10          
J100085L22          
J100085M20          
J100086G15          
J100086N03          
J100087E11          
J100087I01          
J100088C17          
J100088N20          
J100089I18          
J100089M13          
J100090E17          
J100090J19          
TSS from cDNA
TSS information
J065083P21                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065083P21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+27286691-108

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGGCTATAAATC+2728665327286664-146-135
Y PatchTCTTCCCC+2728668327286690-116-109
Y PatchTTCTCCTCCCCCTCCC+2728671527286730-84-69
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCCCCCACCGTCGGAT+2728660527286621-194-178
 OsREG438ACCCCCCA          PPDB Motif  PLACE Motif 
 OsREG546        CCGTCGGA  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483         CGTCGGAT PPDB MotifCCGAC  PLACE MotifCGACG 
REGGGACGGCC+2728662927286636-170-163
 OsREG624GGACGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCTGGGCCAC+2728684527286854J080016B03, J080071M07
 OsREG550CCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653  TGGGCCAC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.