version
PlantPromoterDB promoter information of J065092H13

Summary of Gene (J065092H13)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0603200        NCBI 
Gene model J065092H13  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 25319816-25321015)

Genome position     
from initiation codon
012-003-E12         
AK112078            
J033105B08          
J033111H09          
J065136P15          
J065171E23          
J065205G15          
J090017H20          
J090023O14          
J090093O20          
TSS from cDNA
TSS information
J065092H13                       5'->3' (+)
Promoter sequence

 
AK101352            
J023077E09          
J023081N15          
J033022N22          
J033024M18          
J033034P09          
J033046A06          
J033051K01          
J033081P09          
J033091B17          
J033092K23          
J033132J09          
J033144A14          
J033145A14          
J053024D23          
J065212J10          
J090055M05          
J090065E14          
J090092J06          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065092H13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakCclone-25320003AK101352, J053024D23, J033034P09, J033046A06, J023077E09, AK101352, J090055M05, J033081P09, J043021B20, J033051K01, J065212J10, J033092K23, J090065E14, J090092J06, J033132J09, J023081N15, J033024M18, J033145A14, J033144A14, J033091B17, J033022N22

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCGCTATAAACC-2532002725320038AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
Y PatchTCCTTCCTC-2531997125319979AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
Y PatchCCTCCTCTCTCC-2531999325320004AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
Y PatchCCCCTCTCTCTTTCTCTCTC-2532000925320028AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
Y PatchCCTTCCTC-2532003725320044AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGCGTGGGGCCCACCA-2532005725320072AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG530CGCGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG572  CGTGGGGC       PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC      PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599        GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGAGTGACAC-2532008125320088AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG477AGTGACAC PPDB Motif  PLACE MotifTGAC 
REGGGGGCCCACA-2532009325320102AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG647GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCATGG-2532014225320152AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTCATGGGCCTGG-2532015525320166AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG609TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474  ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524    GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGGCGGGCCCACACAGCCCACCAC-2532018325320204AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG619GCGGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG566 CGGGCCCA              PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640  GGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA            PPDB MotifGCCCA  PLACE Motif 
 OsREG598    GCCCACAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG435          ACAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG462            AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599             GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527              CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCGGA-2532021925320230AK101352, J023077E09, J023081N15, J033022N22, J033024M18, J033034P09, J033046A06, J033051K01, J033081P09, J033091B17, J033092K23, J033132J09, J033144A14, J033145A14, J043021B20, J053024D23, J065212J10, J090055M05, J090065E14, J090092J06
 OsREG609TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.