version
PlantPromoterDB promoter information of J065095L06

Summary of Gene (J065095L06)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0287000        NCBI 
Gene model J065095L06  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 10855592-10854393)

Genome position     
from initiation codon
006-107-B10         
006-120-E07         
AF052503            
AK059647            
AK099131            
J023048M05          
J033107L10          
J065019A12          
J065064J21          
J065071D15          
J065094L12          
J065097J11          
J065099M08          
J065104D01          
J065107L02          
J065110D14          
J065135J07          
J065137C16          
J065150C07          
J065165I10          
J065189F07          
J065205L22          
J065214C09          
J065217G17          
J075029E17          
J075054O16          
J075068N23          
J075135N18          
J075152G09          
J075162D10          
J075164F11          
J080036L12          
J080049K18          
J080060P03          
J080062G16          
J080062G21          
J080064N07          
J080075I22          
J080086F20          
J080087G07          
J080088I06          
J080302B20          
J080303L14          
J080309O12          
J080317F12          
J080317P18          
J090013L15          
J090043N04          
J090085G01          
J090085G19          
TSS from cDNA
TSS information
J065095L06                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065095L06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-10854663-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCC-1085470410854711-112-119
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCGTCCGATC-1085471810854729-126-137
 OsREG468AGCCGTCC     PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545  CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484   CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589    GTCCGATC PPDB Motif  PLACE Motif 
REGGCTGGGCT-1085475810854765-166-173
 OsREG464GCTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCG-1085477710854784-185-192
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGGCTGGGCT-1085484910854856-257-264
 OsREG464GCTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGGCTCAGCT-1085489010854897-298-305
 OsREG470GCTCAGCT PPDB Motif  PLACE Motif 
REGAAATGGGCCTC-1085490110854911-309-319
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCTTA-1085493810854947-346-355
 OsREG459CTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426 TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655  TGGGCTTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.