version
PlantPromoterDB promoter information of J065097A08

Summary of Gene (J065097A08)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0497000        NCBI 
Gene model J065097A08  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 19496085-19497284)

Genome position     
from initiation codon
AK111924            
J065090J11          
J065123J10          
J075096F04          
J080065C15          
J090033J04          
J090072N23          
J100021E08          
J100063H21          
TSS from cDNA
TSS information
J065097A08                       5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065097A08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+19496971-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCC+1949701219497019-73-66
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCTGGCCCATCAGCCCATATAGCCCATCA+1949679019496821-295-264
 OsREG524GGGCCTGG                         PPDB MotifGCCCA  PLACE Motif 
 OsREG577    CTGGCCCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG488     TGGCCCAT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG590      GGCCCATC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG607       GCCCATCA         GCCCATCA PPDB MotifGCCCA  PLACE Motif 
 OsREG657            TCAGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG491             CAGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG465              AGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG480               GCCCATAT          PPDB MotifGCCCA  PLACE Motif 
 OsREG466                       AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGAAA+1949683019496838-255-247
 OsREG642GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634 GGCCGAAA PPDB Motif  PLACE Motif 
REGGCTGGGCCGTT+1949684519496855-240-230
 OsREG620GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423   GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
REGCAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAAT+1949686019496892-225-193
 OsREG497CAAGGCCCAAGGCCCAAGGCCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCAAGGCCCAAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAAGGCCCAAGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAGGCCCAAG                PPDB MotifGCCCA  PLACE Motif 
 OsREG625                 GGCCCAAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG421                      AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426                       AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG457                        AGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493                         GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.