version
PlantPromoterDB promoter information of J065099C01

Summary of Gene (J065099C01)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0391100        NCBI 
Gene model J065099C01  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 16772504-16771305)

Genome position     
from initiation codon
012-001-B05         
012-053-F01         
AK063499            
AK108533            
AK121200            
J023042H11          
J023087I02          
J065021A04          
J065076H06          
J065181E05          
J065187A05          
J075036C17          
J075051C18          
J075063L16          
J075079M08          
J075112H15          
J075135F10          
J075164H06          
J075195N02          
TSS from cDNA
TSS information
J065099C01                       5'->3' (-)
Promoter sequence






 
                    
Os01g0391200        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065099C01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-16772275-771

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGGCCCAAA-1677237516772385-871-881
 OsREG638TCTGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGCGCGTGGGACCCACCTG-1677239016772406-886-902
 OsREG530CGCGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG650   GTGGGACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG648    TGGGACCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG637     GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622      GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG514         CCCACCTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.