PlantPromoterDB promoter information of J065109F16

Summary of Gene (J065109F16)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0757900        NCBI 
Gene model J065109F16  
Description NONE  


Focused view (chromosome 2: 32808383-32807184)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J065109F16                       5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of J065109F16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakCclone-32807462-79
TSS clone peakCclone-32807427-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG440ACCGGCCC                PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG592         TTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625          TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639           TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640             GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600               GCCCACCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakAclone+32807721AK064389, AK105464, 014-078-E02, 014-004-B07, 014-002-E03, 014-081-H11, 016-060-C11, AK064389, 014-038-F03, AK074003, 013-065-E04, 014-072-G02, J033076P21

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGGGGTGGGCCCAAAACGGGCCGGT+3280748232807504013-065-E04, 014-002-E03, 014-004-B07, 014-038-F03, 014-072-G02, 014-078-E02, 014-081-H11, 016-060-C11, AK064389, AK074003, AK105464, J033076P21
 OsREG600GGGTGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG625     GGCCCAAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG592      GCCCAAAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG440               GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTCGGCCCATCT+3280752732807537013-065-E04, 014-002-E03, 014-004-B07, 014-038-F03, 014-072-G02, 014-078-E02, 014-081-H11, 016-060-C11, AK064389, AK074003, AK105464, J033076P21

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.