version
PlantPromoterDB promoter information of J065116G03

Summary of Gene (J065116G03)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0503800        NCBI 
Gene model J065116G03  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 25547899-25549098)

Genome position     
from initiation codon
AK121895            
J033105D14          
TSS from cDNA
TSS information
J065116G03                       5'->3' (+)
Promoter sequence









 
011-054-G09         
AK063355            
AK099738            
J075026D20          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065116G03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+25548316-583

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCCTCTCCCCC+2554830025548316-599-583
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGCGGTG+2554809825548105-801-794
 OsREG500GTGCGGTG PPDB Motif  PLACE Motif 
REGGGCTGGGC+2554818025548187-719-712
 OsREG603GGCTGGGC PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGCCAG+2554818925548199-710-700
 OsREG592TTTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCAGCCCAGTA+2554823025548246-669-653
 OsREG615GCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG620   GGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533     CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523      CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG512       CAGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG604         GCCCAGTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.