version
PlantPromoterDB promoter information of J065120G22

Summary of Gene (J065120G22)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0660600        NCBI 
Gene model J065120G22  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34122792-34121593)

Genome position     
from initiation codon
009-113-A11         
AK120899            
J023030J05          
J065068M07          
J065168J18          
J065211M10          
J075175E21          
J090021C06          
J090032P15          
J090082E05          
J100090O11          
TSS from cDNA
TSS information
J065120G22                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065120G22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-34121915-123

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCCC-3412189834121906-106-114
Y PatchTTCCTCTT-3412191434121921-122-129
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGGCCCAATT-3412197134121983-179-191
 OsREG539CCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG639   GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433     GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCAGAT-3412199034122001-198-209
 OsREG497CAAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473  AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486    GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGTTGTGGGCCCAAAC-3412201434122027-222-235
 OsREG597TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625     GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593      GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCCCACTTG-3412204034122054-248-262
 OsREG437ACATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498       CCCACTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.