version
PlantPromoterDB promoter information of J065122F20

Summary of Gene (J065122F20)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0185700        NCBI 
Gene model J065122F20  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 4576099-4577298)

Genome position     
from initiation codon
012-040-A11         
AK070572            
J013074B04          
J023008M14          
J023055P17          
J023056J22          
J065116D10          
TSS from cDNA
TSS information
J065122F20                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065122F20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+4577076-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCCCTC+45770274577039-72-60
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTGGGCCGA+45769544576963-145-136
 OsREG550CCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA PPDB MotifGCCCA  PLACE Motif 
REGGCCCGGCCCATAT+45769664576978-133-121
 OsREG614GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538 CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542  CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630    GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480     GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCACCAC+45769844576995-115-104
 OsREG496CAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGAGGGCCCACGGGCCCATCG+45769974577015-102-84
 OsREG475AGGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG          PPDB MotifGCCCA  PLACE Motif 
 OsREG547   GCCCACGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG531    CCCACGGG        PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG566        CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG489         GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590          GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG553           GCCCATCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.