version
PlantPromoterDB promoter information of J065122L11

Summary of Gene (J065122L11)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0807800        NCBI 
Gene model J065122L11  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 34621726-34622925)

Genome position     
from initiation codon
006-056-G10         
AK060962            
AK070287            
J023049O16          
J100025I21          
J100035K21          
TSS from cDNA
TSS information
J065122L11                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065122L11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+34619713-513

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGTATAAATA+3461967934619689-547-537
Y PatchCCCTTCTCC+3461969034619698-536-528
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGGCCCAAT+3461946734619476-759-750
 OsREG513CAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGAATGGGCTTA+3461951834619527-708-699
 OsREG432AATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429 ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655  TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCATG+3461956134619570-665-656
 OsREG487ATGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTGATGGGCCTGA+3461957534619586-651-640
 OsREG607TGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCCGAAGAGGCCCAGCCCACTTG+3461960634619634-620-592
 OsREG596TATTGGGC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG                    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA                  PPDB MotifGCCCA  PLACE Motif 
 OsREG587            GAGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG473             AGGCCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG620              GGCCCAGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG603               GCCCAGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG533                CCCAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG523                 CCAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG498                     CCCACTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+34622451AK060962, AK060962, 006-056-G10, J100025I21, J100035K21, AK070287, J023049O16

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACACGTGGGGCCCGGC+3462233134622347006-056-G10, AK060962, AK070287, J023049O16, J100025I21, J100035K21
 OsREG509GACACGTG          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434 ACACGTGG         PPDB MotifACGT  PLACE Motif 
 OsREG508  CACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG450   ACGTGGGG       PPDB MotifACGT  PLACE Motif 
 OsREG572    CGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631     GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641      TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567       GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG543        GGGCCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG616         GGCCCGGC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.