version
PlantPromoterDB promoter information of J065123E01

Summary of Gene (J065123E01)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0762400        NCBI 
Gene model J065123E01  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 32381149-32382348)

Genome position     
from initiation codon
AK071181            
J023084I20          
J033039C18          
J033108N03          
J043017N16          
J065026C13          
J065045C01          
J065045D11          
J065050N09          
J065058P21          
J065075I20          
J065077I17          
J065081I20          
J065085B14          
J065101K21          
J065112A17          
J065112N13          
J065118J02          
J065134N12          
J065139L04          
J065141I11          
J065161J24          
J065164I10          
J065171L01          
J065178P21          
J065185L24          
J065219C04          
J075029B07          
J075033G20          
J075054N01          
J075068B22          
J075096N11          
J075098C11          
J075115J22          
J075127D11          
J075156J21          
J075166G08          
J075166P17          
J075170O18          
J075181A16          
J075195J11          
TSS from cDNA
TSS information
J065123E01                       5'->3' (+)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065123E01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+32381578-571

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGTGGGGGC+3238128032381289-869-860
 OsREG450ACGTGGGG   PPDB MotifACGT  PLACE Motif 
 OsREG536 CGTGGGGG  PPDB Motif  PLACE Motif 
 OsREG613  GTGGGGGC PPDB Motif  PLACE Motif 
REGCTCTCCGC+3238131332381320-836-829
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGGGCCGTGG+3238132832381335-821-814
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGCATCCACCGCACCGC+3238135332381367-796-782
 OsREG515CATCCACC        PPDB Motif  PLACE Motif 
 OsREG500    CACCGCAC    PPDB Motif  PLACE Motif 
 OsREG554       CGCACCGC PPDB Motif  PLACE Motif 
REGATCTCGGC+3238138832381395-761-754
 OsREG485ATCTCGGC PPDB Motif  PLACE Motif 
REGGCGACGCG+3238142232381429-727-720
 OsREG559GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGCCCACTCC+3238145432381461-695-688
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.