version
PlantPromoterDB promoter information of J065123E19

Summary of Gene (J065123E19)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0223100        NCBI 
Gene model J065123E19  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 6840823-6842022)

Genome position     
from initiation codon
006-044-G07         
006-071-E10         
006-077-A04         
009-162-H05         
J023050M10          
J023055F05          
J023060I11          
J023101M01          
J065059J21          
J065087I18          
J065113L17          
J065137O04          
J065217M03          
J090012O14          
J090014C13          
J090060C24          
J100037H14          
J100060E10          
J100067L04          
J100075G09          
J100077C15          
TSS from cDNA
TSS information
J065123E19                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065123E19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6841439-384

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTCT+68414796841487-344-336
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCACGG+68412286841238-595-585
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG547   GCCCACGG PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGC+68412576841264-566-559
 OsREG479AGTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCCACGCGTCCCACC+68413636841377-460-446
 OsREG530CCCACGCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG443 CCACGCGT       PPDB Motif  PLACE Motif 
 OsREG442   ACGCGTCC     PPDB Motif  PLACE Motif 
 OsREG651       GTCCCACC PPDB MotifGGGACCC  PLACE Motif 
REGCGCGTCGC+68413846841391-439-432
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.