PlantPromoterDB promoter information of J065124B15
Summary of Gene (J065124B15)
|
Overview
|
Focused view (chromosome 8: 26495857-26494658)
|
Genome position
from initiation codon AK062052 AK120448 J013100M19 J023045K22 J033046D13 J033066N01 J033143N05 J053070P13 J065011C18 J065013C23 J065016B09 J065016C21 J065023K18 J065028F12 J065030L02 J065042H15 J065078H02 J065092D07 J065092E01 J065103F10 J065104M21 J065119P21 J065146H09 J065149L09 J065156A09 J065157H23 J065165L14 J065165M18 J065172O03 J065192M18 J065198D21 J065200D05 J065202B20 J065212P11 J065215E08 J065217P19 J075005I19 J075134J06 J075162G12 J075178H07 J075186K01 J080315I17 J080318P19 J090004H16 J090020A16 J090047J12 J090080E07 J090090H23 J100021G24 J100037L04 J100043L09 J100044A10 TSS from cDNA TSS information J065124B15 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of J065124B15
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | C | clone | - | 26496532 | -125 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CCTCCTCTT | - | 26496511 | 26496519 | -104 | -112 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TTTTGGGCCC | - | 26496573 | 26496582 | -166 | -175 | |||
| OsREG592 | TTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG625 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG639 | TTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | AGCCCACAATAATGGGCCAG | - | 26496629 | 26496648 | -222 | -241 | |||
| OsREG461 | AGCCCACA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG597 | GCCCACAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG610 | TAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG431 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG488 | ATGGGCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG577 | TGGGCCAG | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | AAATGGGCCTA | - | 26496665 | 26496675 | -258 | -268 | |||
| OsREG422 | AAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG431 | AATGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG474 | ATGGGCCT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG656 | TGGGCCTA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||