version
PlantPromoterDB promoter information of J065124B19

Summary of Gene (J065124B19)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0752300        NCBI 
Gene model J065124B19  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33317566-33316367)

Genome position     
from initiation codon
AK121755            
J013049F10          
J013088L10          
J023020B21          
J023038M01          
J033058H15          
J033088C04          
J033115N19          
J033131H04          
J065067E05          
J065085C07          
J065095D12          
J065181H07          
J065197B09          
J075090K22          
J075101P17          
J075181F13          
J075190H19          
J090004P17          
J090066I03          
Os01g0752400        
TSS from cDNA
TSS information
J065124B19                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065124B19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33316682-116

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCT-3331666833316675-102-109
Y PatchCTCCTCCTCTCC-3331668333316694-117-128
Y PatchCCTCTCTCC-3331669833316706-132-140
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAGCCCATAT-3331674033316750-174-184
 OsREG523CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCTTCGGCCCATGA-3331675933316778-193-212
 OsREG480ATATGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG582   TGGGCTTC          PPDB MotifGCCCA  PLACE Motif 
 OsREG642        TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658         TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490          CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517           GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609            GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGTT-3331679133316798-225-232
 OsREG424GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.