version
PlantPromoterDB promoter information of J065130O18

Summary of Gene (J065130O18)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0597625        NCBI 
Gene model J065130O18  
Description D-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein.  
#
#

Overview

Focused view (chromosome 7: 25029895-25031094)

Genome position     
from initiation codon
J065166J07          
TSS from cDNA
TSS information
J065130O18                       5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065130O18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25030891-4

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCTCTCT+2503085025030859-45-36
Y PatchTCCTCTCTCTCCCCTCTCCTC+2503086125030881-34-14
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGTCCCTCA+2503060525030615-290-280
 OsREG569CGGGTCCC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG652   GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGGACGTGGC+2503071325030720-182-175
 OsREG585GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGTGGGACCCAC+2503077225030781-123-114
 OsREG648TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622  GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGGTGGGACCCACGTGGC+2503081625030832-79-63
 OsREG651GGTGGGAC          PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC         PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA       PPDB MotifGGGACCC  PLACE Motif 
 OsREG622    GGACCCAC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG508       CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG507         CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.