version
PlantPromoterDB promoter information of J065137I02

Summary of Gene (J065137I02)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0683900        NCBI 
Gene model J065137I02  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 29663455-29664654)

Genome position     
from initiation codon
006-064-B09         
006-084-B03         
006-102-F10         
011-057-F12         
011-098-A02         
012-012-H02         
013-099-D06         
AK103324            
J013098G05          
J023138L02          
J033030M14          
J033111J21          
J033125K07          
J033131O15          
J033135I19          
J043016G14          
J043020F07          
J043022F24          
J043022J03          
J065005N24          
J065083B02          
J065093J20          
J065096H24          
J065111H06          
J065128C09          
J065136L13          
J065147B15          
J065163I16          
J075013E11          
J075018H08          
J075019C23          
J075051C07          
J075062A21          
J075065K07          
J075095E05          
J075128H08          
J075137J06          
J075180M24          
J075193A04          
J075198J06          
J075199C21          
J090021J16          
J090029K24          
J090055L04          
J090069J18          
J090081H06          
J100034E19          
J100048P04          
J100052M01          
J100066L01          
J100081K17          
Y08987              
TSS from cDNA
TSS information
J065137I02                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065137I02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+29664376-79

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATAAAAC+2966434429664353-111-102
Y PatchCTCCTCCTC+2966436729664375-88-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTGGGCCCAGC+2966423929664250-216-205
 OsREG628GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG579   GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620    GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCG+2966429529664302-160-153
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGTCGGA+2966449729664504004-013-C10, AK060899, J065096G16, J090003A20, J090058E17, J100028P13, J100046H21, J100078H20
 OsREG546CCGTCGGA PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCTCGCCC+2966458029664587004-013-C10, AK060899, J065096G16, J090003A20, J090058E17, J100028P13, J100046H21, J100078H20
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.