version
PlantPromoterDB promoter information of J065137N17

Summary of Gene (J065137N17)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0527000        NCBI 
Gene model J065137N17  
Description Conserved hypothetical protein.  
#
#

Overview

Focused view (chromosome 11: 20954011-20955210)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J065137N17                       5'->3' (+)
Promoter sequence









 
AK102583            
J023039F04          
J033098D23          
J033105H14          
J090067O12          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065137N17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+20954718-293

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTATAAATT+2095467920954688-332-323
Y PatchCCCCCCCC+2095469920954706-312-305
Y PatchCCTCTCTCTCCC+2095470920954720-302-291
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGTGGGC+2095444320954451-568-560
 OsREG527GTGGTGGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG599 TGGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCCCCACCTGTC+2095461920954635-392-376
 OsREG517CATGGGCC          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489 ATGGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC      PPDB Motif  PLACE Motif 
 OsREG612     GCCCCACC     PPDB Motif  PLACE Motif 
 OsREG514       CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC PPDB Motif  PLACE Motif 
REGGTGGGTCCCACCTGTC+2095464520954660-366-351
 OsREG622GTGGGTCC         PPDB MotifGGGACCC  PLACE Motif 
 OsREG637 TGGGTCCC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  GGGTCCCA       PPDB MotifGGGACCC  PLACE Motif 
 OsREG650   GGTCCCAC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG651    GTCCCACC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG514      CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436       CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501        CACCTGTC PPDB Motif  PLACE Motif 
REGAAAAGCCC+2095467020954677-341-334
 OsREG419AAAAGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.