version
PlantPromoterDB promoter information of J065139O15

Summary of Gene (J065139O15)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0668200        NCBI 
Gene model J065139O15  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 28557556-28556357)

Genome position     
from initiation codon
011-004-A12         
AK070705            
AK101622            
D10408              
J033044L05          
J033052L01          
J033086F09          
J033096I19          
J033136J07          
J053066C24          
J053068G13          
J053072J20          
J065007C17          
J065033G23          
J065057N22          
J065074N09          
J065075K09          
J065130L15          
J065132D22          
J065136P12          
J065137M09          
J065153A11          
J075003J03          
J075021J20          
J075151J12          
J075179M22          
J090014G23          
J090018A18          
J090032I11          
J090066C02          
TSS from cDNA
TSS information
J065139O15                       5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065139O15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone-28556753-197
TSS clone peakGclone-28556751-195

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAAAG-2855678228556789-226-233
Y PatchCCTTCCTC-2855675228556759-196-203
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGACAGGTGG-2855681028556820-254-264
 OsREG551CTGACAGG    PPDB Motif  PLACE MotifTGAC 
 OsREG501  GACAGGTG  PPDB Motif  PLACE Motif 
 OsREG436   ACAGGTGG PPDB Motif  PLACE Motif 
REGGTGGGACCCAC-2855686528556875-309-319
 OsREG650GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637  GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622   GGACCCAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.