version
PlantPromoterDB promoter information of J065142M24

Summary of Gene (J065142M24)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0540000        NCBI 
Gene model J065142M24  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 21676858-21675659)

Genome position     
from initiation codon
AK108630            
J065046N02          
J065100H24          
TSS from cDNA
TSS information
J065142M24                       5'->3' (-)
Promoter sequence






 
                    
Os12g0540400        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065142M24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-21676388-530

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCTT-2167638121676389-523-531
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAGCCCGAGCCG-2167648021676493-622-635
 OsREG519CCAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG540      CCGAGCCG PPDB Motif  PLACE Motif 
REGCCGAGCCG-2167651121676518-653-660
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGGGGCTTGG-2167653621676543-678-685
 OsREG519GGGCTTGG PPDB MotifGCCCA  PLACE Motif 
REGCGGCTCGG-2167657121676578-713-720
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 
REGTAATGGGCTTGGGCT-2167664721676661-789-803
 OsREG610TAATGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT       PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT      PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG459       CTTGGGCT PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCAGA-2167666921676680-811-822
 OsREG609TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488  ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.