version
PlantPromoterDB promoter information of J065143M22

Summary of Gene (J065143M22)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0445200        NCBI 
Gene model J065143M22  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 22304225-22303026)

Genome position     
from initiation codon
009-034-A06         
AK062427            
AK119720            
J065022E20          
J065062D16          
J065081I02          
J065087C10          
J065116N16          
J065132F10          
J065140F18          
J065158K17          
J065162D07          
J065207H19          
J075155B20          
J075167E24          
J075178B19          
J080301D22          
J080301J15          
J080308J02          
TSS from cDNA
TSS information
J065143M22                       5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065143M22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-22303418-193
TSS clone peakAclone-22303404-179

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCAAAT-2230345322303463-228-238
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG493   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGATCTGGGCCAC-2230350522303515-280-290
 OsREG486ATCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578  CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGACCCCCCACG-2230352522303534-300-309
 OsREG438ACCCCCCA   PPDB Motif  PLACE Motif 
 OsREG536  CCCCCACG PPDB Motif  PLACE Motif 
REGCAAGTGGGCCTC-2230356122303572-336-347
 OsREG498CAAGTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587    TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGGCGGAGAG-2230358222303589-357-364
 OsREG576GCGGAGAG PPDB Motif  PLACE Motif 
REGGTTGGTGGGGGC-2230369722303708-472-483
 OsREG520GTTGGTGG     PPDB MotifCCAACGG  PLACE Motif 
 OsREG613    GTGGGGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.