version
PlantPromoterDB promoter information of J065149M14

Summary of Gene (J065149M14)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0533500        NCBI 
Gene model J065149M14  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 21399227-21398028)

Genome position     
from initiation codon
AK068646            
J013158L10          
J065015O19          
J065083J02          
J065144C03          
J075079D02          
J075083L07          
J075083O13          
J075108M11          
J090057A07          
J100037H16          
J100054P20          
J100057M14          
J100075P13          
TSS from cDNA
TSS information
J065149M14                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065149M14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-21399147AK068646, J100037H16, J100075P13, J075079D02, J065083J02, J013158L10, AK068646

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCGGCCCATCCACCCACTTG-2139919421399214AK068646, J013158L10, J065083J02, J075079D02, J100037H16, J100075P13
 OsREG440ACCGGCCC              PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG608    GCCCATCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG534     CCCATCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG515       CATCCACC       PPDB Motif  PLACE Motif 
 OsREG498             CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCGGCCCAGA-2139921921399234AK068646, J013158L10, J065083J02, J075079D02, J100037H16, J100075P13
 OsREG538CCCGGCCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG544  CGGCCCGG       PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG542      CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565       CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629        GGCCCAGA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.