PlantPromoterDB promoter information of J065149M14

Summary of Gene (J065149M14)

Organism	Oryza sativa
Chromosome	12
Locus	Os12g0533500 NCBI
Gene model	J065149M14
Description	NONE

#

Overview

Focused view (chromosome 12: 21399477-21398278)

`Genome position from initiation codon` AK068646 J013158L10 J065015O19 J065083J02 J065144C03 J075079D02 J075083L07 J075083O13 J075108M11 J090057A07 J100037H16 J100054P20 J100057M14 J100075P13 TSS from cDNA TSS information J065149M14 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065149M14

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone peak G clone - 21399147 AK068646, J100037H16, J100075P13, J075079D02, J065083J02, J013158L10, AK068646

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone peak	`G`	clone	-	21399147	AK068646, J100037H16, J100075P13, J075079D02, J065083J02, J013158L10, AK068646

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG ACCGGCCCATCCACCCACTTG - 21399194 21399214 AK068646, J013158L10, J065083J02, J075079D02, J100037H16, J100075P13

OsREG440 ACCGGCCC              PPDB Motif GCCCA, AACCG(G/A) PLACE Motif

OsREG542 CCGGCCCA             PPDB Motif GCCCA PLACE Motif

OsREG490   CGGCCCAT            PPDB Motif GCCCA PLACE Motif

OsREG590    GGCCCATC           PPDB Motif GCCCA PLACE Motif

OsREG608     GCCCATCC          PPDB Motif GCCCA PLACE Motif

OsREG534      CCCATCCA         PPDB Motif GCCCA PLACE Motif

OsREG515        CATCCACC       PPDB Motif PLACE Motif

OsREG498              CCCACTTG PPDB Motif GCCCA PLACE Motif

REG TCGGCCCGGCCCGGCCCAGA - 21399219 21399238 AK068646, J013158L10, J065083J02, J075079D02, J100037H16, J100075P13

OsREG568 TCGGCCCG             PPDB Motif ACGGGC PLACE Motif

OsREG544 CGGCCCGGCCCGG       PPDB Motif PLACE Motif

OsREG616   GGCCCGGCCCGGC      PPDB Motif PLACE Motif

OsREG614    GCCCGGCCCGGCC     PPDB Motif PLACE Motif

OsREG538     CCCGGCCCGGCCC    PPDB Motif GCCCA PLACE Motif

OsREG542           CCGGCCCA   PPDB Motif GCCCA PLACE Motif

OsREG565            CGGCCCAG PPDB Motif GCCCA PLACE Motif

OsREG629             GGCCCAGA PPDB Motif GCCCA PLACE Motif

REG GGGCTGGGCCGCGTGGGCCAA - 21399243 21399263 AK068646, J013158L10, J065083J02, J075079D02, J100037H16, J100075P13

OsREG533 GGGCTGGG              PPDB Motif GCCCA PLACE Motif

OsREG603 GGCTGGGC             PPDB Motif GCCCA PLACE Motif

OsREG620   GCTGGGCC            PPDB Motif GCCCA PLACE Motif

OsREG565    CTGGGCCG           PPDB Motif GCCCA PLACE Motif

OsREG618     TGGGCCGC          PPDB Motif GCCCA PLACE Motif

OsREG530          CGCGTGGG     PPDB Motif GCCCA PLACE Motif

OsREG602           GCGTGGGC    PPDB Motif GCCCA PLACE Motif

OsREG571            CGTGGGCC   PPDB Motif GCCCA PLACE Motif

OsREG654             GTGGGCCA PPDB Motif GCCCA PLACE Motif

OsREG660              TGGGCCAA PPDB Motif GCCCA PLACE Motif

REG AGCCGTTG - 21399279 21399286 AK068646, J013158L10, J065083J02, J075079D02, J100037H16, J100075P13

OsREG469 AGCCGTTG PPDB Motif CCAACGG PLACE Motif