version
PlantPromoterDB promoter information of J065152K09

Summary of Gene (J065152K09)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0661400        NCBI 
Gene model J065152K09  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 28552242-28551043)

Genome position     
from initiation codon
006-083-E05         
006-084-B12         
006-096-B03         
009-013-C12         
009-017-C10         
009-027-A02         
009-035-A06         
009-047-H11         
009-050-B11         
009-089-G06         
009-095-B11         
009-151-C01         
009-154-F06         
009-169-F02         
009-171-G01         
009-179-F07         
013-018-H06         
013-024-E05         
013-038-F09         
013-099-F06         
014-042-E09         
014-086-C02         
014-093-B08         
015-039-G11         
016-036-E05         
AK068814            
AK102682            
AK105973            
AK107202            
J053035N21          
J053099D11          
J065023B18          
J065031M15          
J065035G23          
J065060M18          
J065073J18          
J065103E20          
J065105N19          
J065137A08          
J065156M12          
J065162G23          
J065162L13          
J065163H16          
J065165E06          
J065171J04          
J065180L23          
J065183K23          
J065186H13          
J065195D10          
J065209G11          
J075006J08          
J075112O07          
J080301H14          
J100058C17          
J100077I23          
J100080I24          
TSS from cDNA
TSS information
J065152K09                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065152K09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28551474-232
TSS clone peakAclone-28551470-228

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC-2855143928551446-197-204
Y PatchTCCCCCTCC-2855148528551493-243-251
Y PatchCTCCTCCCCTCTC-2855150928551521-267-279
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGGCCCCACCACCCCACCCG-2855152828551549-286-307
 OsREG538CCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC            PPDB Motif  PLACE Motif 
 OsREG612    GCCCCACC           PPDB Motif  PLACE Motif 
 OsREG527      CCCACCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG528              CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCCACTGACA-2855155128551559-309-317
 OsREG522CCACTGAC  PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA PPDB Motif  PLACE MotifTGAC 
REGCCCGGCCCCACACG-2855157028551583-328-341
 OsREG538CCCGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG631   GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG611    GCCCCACA   PPDB Motif  PLACE Motif 
 OsREG535     CCCCACAC  PPDB Motif  PLACE Motif 
 OsREG526      CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCCCACACG-2855158828551595-346-353
 OsREG526CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGCATCCACC-2855161528551622-373-380
 OsREG515CATCCACC PPDB Motif  PLACE Motif 
REGGGGACCCA-2855164528551652-403-410
 OsREG637GGGACCCA PPDB MotifGGGACCC  PLACE Motif 
REGGGCCCCACCCCCCA-2855166228551675-420-433
 OsREG631GGCCCCAC       PPDB Motif  PLACE Motif 
 OsREG612 GCCCCACC      PPDB Motif  PLACE Motif 
 OsREG438      ACCCCCCA PPDB Motif  PLACE Motif 
REGCCTCGCCC-2855171428551721-472-479
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.