version
PlantPromoterDB promoter information of J065152M15

Summary of Gene (J065152M15)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0658300        NCBI 
Gene model J065152M15  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 27506268-27507467)

Genome position     
from initiation codon
AK073923            
TSS from cDNA
TSS information
J065152M15                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065152M15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+27507188-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCTTCCTC+2750721927507231-49-37
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACAGCCCATTA+2750703027507040-238-228
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCCAA+2750704727507056-221-212
 OsREG581CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660  TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCATTA+2750707727507087-191-181
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA PPDB MotifGCCCA  PLACE Motif 
REGTCTGGCCCAACA+2750710527507116-163-152
 OsREG638TCTGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG577 CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG659  TGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.