version
PlantPromoterDB promoter information of J065153F02

Summary of Gene (J065153F02)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0113800        NCBI 
Gene model J065153F02  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 748940-750139)

Genome position     
from initiation codon
012-081-B02         
AK065925            
J013047E20          
J065026F21          
J065047B03          
J065054J12          
J065079M24          
J065080I23          
J065093M07          
J065155E21          
J065179H15          
J075019N02          
J075089E01          
J090054A22          
J090066I18          
J090087K20          
J100079F05          
TSS from cDNA
TSS information
J065153F02                       5'->3' (+)
Promoter sequence











 
012-076-G07         
AK103835            
J023003J02          
J023036H22          
J023052G08          
J023120B20          
J023128G06          
J033024L04          
J033075N22          
J033144J03          
J033145J03          
J033148E17          
J090059L11          
J090080O12          
J090089C03          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065153F02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+749792-148

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTC+749827749837-113-103
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTGG+749582749589-358-351
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGTTTTGGGCCGGCCCAGG+749659749675-281-265
 OsREG592TTTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG615    GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565        CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550         GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCGGCCCAACT+749680749697-260-243
 OsREG521CCACGGCC           PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG446  ACGGCCCG         PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG        PPDB Motif  PLACE Motif 
 OsREG616    GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614     GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538      CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542       CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563        CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626         GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479          GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGCCCCAG+749716749729-224-211
 OsREG528CGGGTGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GGGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG580      GGCCCCAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-749604AK103835, AK103835

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCTGGGCCGGCCCAAAA-749659749675AK103835
 OsREG550CCTGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG615   GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625        GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592         GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCCGGGCCGTGG-749680749697AK103835
 OsREG479AGTTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC          PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC      PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC     PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG    PPDB Motif  PLACE Motif 
 OsREG446        CGGGCCGT   PPDB MotifACGGGC  PLACE Motif 
 OsREG504         GGGCCGTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG521          GGCCGTGG PPDB Motif  PLACE Motif 
REGCTGGGGCCCACCCG-749716749729AK103835
 OsREG580CTGGGGCC       PPDB Motif  PLACE Motif 
 OsREG641 TGGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647  GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG600     GCCCACCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG528      CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGCCGAGCCG-749810749817AK103835
 OsREG540CCGAGCCG PPDB Motif  PLACE Motif 
REGATCTGGGC-749858749865AK103835
 OsREG486ATCTGGGC PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.