version
PlantPromoterDB promoter information of J065157M07

Summary of Gene (J065157M07)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0291000        NCBI 
Gene model J065157M07  
Description Non-protein coding transcript, hold transcript.  
#
#

Overview

Focused view (chromosome 12: 11260287-11261486)

Genome position     
                    
TSS from cDNA
TSS information
J065157M07                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065157M07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGCCCATCC+1126142611261433013-021-D10, 013-038-B12, AK068555, AY445627, D00644, J013156H12, J023122F15, J065001F13, J065001O16, J065006D15, J065008I17, J065008N22, J065010K05, J065015G11, J065019H21, J065020N17, J065024O18, J065025A04, J065026I06, J065028C06, J065029C01, J065029C06, J065029D16, J065029E02, J065030P11, J065032M13, J065034C06, J065037H24, J065037O14, J065038A12, J065043A05, J065046C06, J065046D22, J065048C14, J065048D24, J065049F19, J065050C04, J065052J16, J065055E07, J065055I04, J065060L04, J065062I15, J065062J11, J065065I12, J065068C24, J065069M04, J065071J22, J065076A12, J065076C24, J065076F09, J065076F16, J065077O06, J065081E14, J065082K22, J065082L04, J065085B02, J065089C21, J065092L07, J065093G08, J065093I19, J065093K24, J065093N04, J065094I09, J065094N19, J065095J17, J065095N24, J065096B17, J065096C02, J065097P18, J065099E07, J065103D23, J065104F04, J065104L17, J065111L14, J065112K11, J065115P09, J065123A02, J065127P14, J065137E16, J065138H20, J065138J11, J065141K23, J065141L14, J065143P04, J065146N12, J065147F21, J065147N15, J065154L06, J065156C09, J065156J18, J065157C19, J065159H23, J065159M08, J065163B19, J065164K14, J065166K07, J065166O07, J065168A18, J065170B18, J065170D18, J065173E05, J065174L23, J065177F08, J065177I05, J065178P20, J065181G24, J065182A07, J065183D24, J065184K10, J065185F09, J065185P10, J065186J16, J065188K23, J065190E22, J065191D06, J065193C05, J065193N13, J065194B15, J065199C03, J065200P19, J065202O18, J065203F16, J065204A15, J065206P13, J065207P12, J065210J24, J065211K01, J065213O21, J065215L18, J065216N22, J065219A16, J065219C24, J075012P04, J075013K19, J075028N24, J075028P16, J075032H22, J075032J18, J075042O14, J075047A04, J075053A16, J075064C23, J075072H11, J075073C03, J075081G11, J075093H04, J075095A11, J075095C13, J075100D18, J075101P08, J075114G11, J075118D19, J075122K13, J075125G22, J075129E22, J075129I07, J075132C12, J075135E24, J075136I06, J075136O07, J075138I07, J075142G08, J075147J22, J075150H20, J075151A15, J075151G24, J075151J20, J075156N21, J075158O12, J075161E05, J075166F17, J075169M10, J075174K15, J075179F17, J075185G15, J075188P12, J075191P15, J075192A13, J075197E23, J075197M02, J075198M16, J080020B11, J080021M20, J080066K02, J080301F01, J080301G19, J080305G02, J080306N09, J080309D21, J080309I02, J080313J11, J080313P09, J080315B10, J080315O13, J080316G02, J080317F03, J080318D17, J080319C10, J090017E03, J090034N22, J090042G07, J090062P21, J090082D08, J090096M13, J100086J22
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGGGTCCAGA+1126144311261450013-021-D10, 013-038-B12, AK068555, AY445627, D00644, J013156H12, J023122F15, J065001F13, J065001O16, J065006D15, J065008I17, J065008N22, J065010K05, J065015G11, J065019H21, J065020N17, J065024O18, J065025A04, J065026I06, J065028C06, J065029C01, J065029C06, J065029D16, J065029E02, J065030P11, J065032M13, J065034C06, J065037H24, J065037O14, J065038A12, J065043A05, J065046C06, J065046D22, J065048C14, J065048D24, J065049F19, J065050C04, J065052J16, J065055E07, J065055I04, J065060L04, J065062I15, J065062J11, J065065I12, J065068C24, J065069M04, J065071J22, J065076A12, J065076C24, J065076F09, J065076F16, J065077O06, J065081E14, J065082K22, J065082L04, J065085B02, J065089C21, J065092L07, J065093G08, J065093I19, J065093K24, J065093N04, J065094I09, J065094N19, J065095J17, J065095N24, J065096B17, J065096C02, J065097P18, J065099E07, J065103D23, J065104F04, J065104L17, J065111L14, J065112K11, J065115P09, J065123A02, J065127P14, J065137E16, J065138H20, J065138J11, J065141K23, J065141L14, J065143P04, J065146N12, J065147F21, J065147N15, J065154L06, J065156C09, J065156J18, J065157C19, J065159H23, J065159M08, J065163B19, J065164K14, J065166K07, J065166O07, J065168A18, J065170B18, J065170D18, J065173E05, J065174L23, J065177F08, J065177I05, J065178P20, J065181G24, J065182A07, J065183D24, J065184K10, J065185F09, J065185P10, J065186J16, J065188K23, J065190E22, J065191D06, J065193C05, J065193N13, J065194B15, J065199C03, J065200P19, J065202O18, J065203F16, J065204A15, J065206P13, J065207P12, J065210J24, J065211K01, J065213O21, J065215L18, J065216N22, J065219A16, J065219C24, J075012P04, J075013K19, J075028N24, J075028P16, J075032H22, J075032J18, J075042O14, J075047A04, J075053A16, J075064C23, J075072H11, J075073C03, J075081G11, J075093H04, J075095A11, J075095C13, J075100D18, J075101P08, J075114G11, J075118D19, J075122K13, J075125G22, J075129E22, J075129I07, J075132C12, J075135E24, J075136I06, J075136O07, J075138I07, J075142G08, J075147J22, J075150H20, J075151A15, J075151G24, J075151J20, J075156N21, J075158O12, J075161E05, J075166F17, J075169M10, J075174K15, J075179F17, J075185G15, J075188P12, J075191P15, J075192A13, J075197E23, J075197M02, J075198M16, J080020B11, J080021M20, J080066K02, J080301F01, J080301G19, J080305G02, J080306N09, J080309D21, J080309I02, J080313J11, J080313P09, J080315B10, J080315O13, J080316G02, J080317F03, J080318D17, J080319C10, J090017E03, J090034N22, J090042G07, J090062P21, J090082D08, J090096M13, J100086J22
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 
REGCGACACGTGGC+1126147411261484013-021-D10, 013-038-B12, AK068555, AY445627, D00644, J013156H12, J023122F15, J065001F13, J065001O16, J065006D15, J065008I17, J065008N22, J065010K05, J065015G11, J065019H21, J065020N17, J065024O18, J065025A04, J065026I06, J065028C06, J065029C01, J065029C06, J065029D16, J065029E02, J065030P11, J065032M13, J065034C06, J065037H24, J065037O14, J065038A12, J065043A05, J065046C06, J065046D22, J065048C14, J065048D24, J065049F19, J065050C04, J065052J16, J065055E07, J065055I04, J065060L04, J065062I15, J065062J11, J065065I12, J065068C24, J065069M04, J065071J22, J065076A12, J065076C24, J065076F09, J065076F16, J065077O06, J065081E14, J065082K22, J065082L04, J065085B02, J065089C21, J065092L07, J065093G08, J065093I19, J065093K24, J065093N04, J065094I09, J065094N19, J065095J17, J065095N24, J065096B17, J065096C02, J065097P18, J065099E07, J065103D23, J065104F04, J065104L17, J065111L14, J065112K11, J065115P09, J065123A02, J065127P14, J065137E16, J065138H20, J065138J11, J065141K23, J065141L14, J065143P04, J065146N12, J065147F21, J065147N15, J065154L06, J065156C09, J065156J18, J065157C19, J065159H23, J065159M08, J065163B19, J065164K14, J065166K07, J065166O07, J065168A18, J065170B18, J065170D18, J065173E05, J065174L23, J065177F08, J065177I05, J065178P20, J065181G24, J065182A07, J065183D24, J065184K10, J065185F09, J065185P10, J065186J16, J065188K23, J065190E22, J065191D06, J065193C05, J065193N13, J065194B15, J065199C03, J065200P19, J065202O18, J065203F16, J065204A15, J065206P13, J065207P12, J065210J24, J065211K01, J065213O21, J065215L18, J065216N22, J065219A16, J065219C24, J075012P04, J075013K19, J075028N24, J075028P16, J075032H22, J075032J18, J075042O14, J075047A04, J075053A16, J075064C23, J075072H11, J075073C03, J075081G11, J075093H04, J075095A11, J075095C13, J075100D18, J075101P08, J075114G11, J075118D19, J075122K13, J075125G22, J075129E22, J075129I07, J075132C12, J075135E24, J075136I06, J075136O07, J075138I07, J075142G08, J075147J22, J075150H20, J075151A15, J075151G24, J075151J20, J075156N21, J075158O12, J075161E05, J075166F17, J075169M10, J075174K15, J075179F17, J075185G15, J075188P12, J075191P15, J075192A13, J075197E23, J075197M02, J075198M16, J080020B11, J080021M20, J080066K02, J080301F01, J080301G19, J080305G02, J080306N09, J080309D21, J080309I02, J080313J11, J080313P09, J080315B10, J080315O13, J080316G02, J080317F03, J080318D17, J080319C10, J090017E03, J090034N22, J090042G07, J090062P21, J090082D08, J090096M13, J100086J22
 OsREG452CGACACGT    PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG509 GACACGTG   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  ACACGTGG  PPDB MotifACGT  PLACE Motif 
 OsREG507   CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.