PlantPromoterDB promoter information of J065158H05

Summary of Gene (J065158H05)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0851100        NCBI 
Gene model J065158H05  
Description NONE  


Focused view (chromosome 3: 36681852-36680653)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J065158H05                       5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence


Promoter Summary of J065158H05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakAclone-36680934-82

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCCTCCTCTC-3668089336680908-41-56
Y PatchCCTCTCCTCCCC-3668093536680946-83-94

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
 OsREG532GGAGTGGG                                                    PPDB MotifGCCCA  PLACE Motif 
 OsREG478  AGTGGGCC          AGTGGGCC          AGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG472   GTGGGCCT          GTGGGCCT                               PPDB MotifGCCCA  PLACE Motif 
 OsREG656    TGGGCCTA          TGGGCCTA                              PPDB MotifGCCCA  PLACE Motif 
 OsREG630          TATGGGCC          TATGGGCC                        PPDB MotifGCCCA  PLACE Motif 
 OsREG489           ATGGGCCC          ATGGGCCC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG475            TGGGCCCT          TGGGCCCT                      PPDB MotifGCCCA  PLACE Motif 
 OsREG564                                       GTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG645                                         GGGCCGTACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445                                        TGGGCCGTACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490                                                 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431                                                  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422                                                   GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS clone peakTclone+36681096AK059425, 009-154-H05, AK059425, J075046G20, J075046O19, J075048O04, J075181I09, 009-134-F10, J080303G20, J065065D24, 009-035-B01, J090086F12, J090088E07

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCT+3668105436681062009-035-B01, 009-134-F10, 009-154-H05, AK059425, J065065D24, J075046G20, J075046O19, J075048O04, J075181I09, J080303G20, J090086F12, J090088E07
Y PatchCTCCCTCTC+3668112636681134009-035-B01, 009-134-F10, 009-154-H05, AK059425, J065065D24, J075046G20, J075046O19, J075048O04, J075181I09, J080303G20, J090086F12, J090088E07

REG information

TypeSequenceAnnotationGenome positionGene model
REGAAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCC+3668099136681049009-035-B01, 009-134-F10, 009-154-H05, AK059425, J065065D24, J075046G20, J075046O19, J075048O04, J075181I09, J080303G20, J090086F12, J090088E07
 OsREG422AAATGGGC                                                    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                                                   PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                                                  PPDB MotifGCCCA  PLACE Motif 
 OsREG645    GGGCCGTACGGCCC                                          PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGTACGGCCCA                                         PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564            CGGCCCAC                                        PPDB MotifGCCCA  PLACE Motif 
 OsREG478             GGCCCACT          GGCCCACT          GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG475                     AGGGCCCA          AGGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG489                      GGGCCCAT          GGGCCCAT            PPDB MotifGCCCA  PLACE Motif 
 OsREG630                       GGCCCATA          GGCCCATA           PPDB MotifGCCCA  PLACE Motif 
 OsREG656                             TAGGCCCA          TAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472                              AGGCCCAC          AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG532                                                   CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.