version
PlantPromoterDB promoter information of J065159G24

Summary of Gene (J065159G24)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0231700        NCBI 
Gene model J065159G24  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 7280152-7278953)

Genome position     
from initiation codon
012-002-F11         
013-082-F05         
AK107453            
J065005L22          
J065023E21          
J065036H21          
J065037M24          
J065049L04          
J065072F17          
J065085H10          
J065109N19          
J065117M19          
J065144C15          
J065164N14          
J075025K16          
J075057L05          
J075070I16          
J075089D10          
J075138F10          
J090018C11          
J100018L19          
J100024B14          
J100048L02          
J100055A22          
J100069K01          
TSS from cDNA
TSS information
J065159G24                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065159G24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-7279221-69

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCC-72791887279195-36-43
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGCCCAAGTAGGCCCAGC-72792737279293-121-141
 OsREG615GCCGGCCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG           PPDB MotifGCCCA  PLACE Motif 
 OsREG656           TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473            AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620             GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCTTTT-72792997279310-147-158
 OsREG609TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGGGCCGAG-72793277279343-175-191
 OsREG480ATATGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG538    GGGCCGGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG614     GGCCGGGC     PPDB Motif  PLACE Motif 
 OsREG616      GCCGGGCC    PPDB Motif  PLACE Motif 
 OsREG544       CCGGGCCG   PPDB Motif  PLACE Motif 
 OsREG568        CGGGCCGA  PPDB MotifACGGGC  PLACE Motif 
 OsREG575         GGGCCGAG PPDB MotifGCCCA  PLACE Motif 
REGATGGCCCATA-72793477279356-195-204
 OsREG487ATGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.