version
PlantPromoterDB promoter information of J065160E20

Summary of Gene (J065160E20)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0545400        NCBI 
Gene model J065160E20  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 22251806-22253005)

Genome position     
from initiation codon
009-136-E03         
013-015-G08         
015-009-B04         
AK059228            
J065040D09          
J065051C19          
J065139B05          
J065207I17          
J080319M24          
TSS from cDNA
TSS information
J065160E20                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065160E20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+22252651-155

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATATAA+2225261222252622-194-184
Y PatchTCCCCTCT+2225262322252630-183-176
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCAGCCCACAGGCCGAGA+2225238622252403-420-403
 OsREG591GCAGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA         PPDB MotifGCCCA  PLACE Motif 
 OsREG635          GGCCGAGA PPDB Motif  PLACE Motif 
REGTCCGGGCCCACGA+2225240522252417-401-389
 OsREG633TCCGGGCC      PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA    PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601     GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCC+2225242222252429-384-377
 OsREG645TACGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGGGTGGGGCCCACC+2225243222252446-374-360
 OsREG528CGGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG612  GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647     GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGCCCACC PPDB MotifGCCCA  PLACE Motif 
REGCCGATCCGACGG+2225252322252534-283-272
 OsREG541CCGATCCG     PPDB Motif  PLACE Motif 
 OsREG588  GATCCGAC   PPDB MotifCCGAC  PLACE Motif 
 OsREG483   ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546    TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCCAGCCCCCACG+2225254722252559-259-247
 OsREG533CCCAGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG613    GCCCCCAC  PPDB Motif  PLACE Motif 
 OsREG536     CCCCCACG PPDB Motif  PLACE Motif 
REGCGCCACGTCACCGATCCG+2225256822252585-238-221
 OsREG448CGCCACGT           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG505   CACGTCAC        PPDB MotifACGT  PLACE MotifTGAC 
 OsREG447    ACGTCACC       PPDB MotifACGT  PLACE MotifTGAC 
 OsREG541          CCGATCCG PPDB Motif  PLACE Motif 
REGCGCGTCTC+2225259222252599-214-207
 OsREG560CGCGTCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.