version
PlantPromoterDB promoter information of J065162G04

Summary of Gene (J065162G04)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0206400        NCBI 
Gene model J065162G04  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 5610977-5609778)

Genome position     
from initiation codon
AK066494            
AK107011            
TSS from cDNA
TSS information
J065162G04                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065162G04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-5610049-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGTGGGCCCGC-56101505610161-173-184
 OsREG600GGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628 GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG566   TGGGCCCG  PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG619    GGGCCCGC PPDB MotifGCCCA  PLACE Motif 
REGCCCGGGCCCGCA-56101745610185-197-208
 OsREG539CCCGGGCC     PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG619   GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632    GGCCCGCA PPDB Motif  PLACE Motif 
REGCCACTGACA-56101875610195-210-218
 OsREG522CCACTGAC  PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA PPDB Motif  PLACE MotifTGAC 
REGGCCCACCC-56102345610241-257-264
 OsREG600GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGCCTGGGCCCCAC-56103165610327-339-350
 OsREG550CCTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG579 CTGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.