version
PlantPromoterDB promoter information of J065163J24

Summary of Gene (J065163J24)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0458400        NCBI 
Gene model J065163J24  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 17978340-17979539)

Genome position     
from initiation codon
AK070055            
AK120321            
J065064N11          
J065083J06          
J065121D24          
J065156I22          
J075001I02          
J090088O06          
TSS from cDNA
TSS information
J065163J24                       5'->3' (+)
Promoter sequence

 
AK120367            
J013069J23          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065163J24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+17978172-118

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGCCCAGA+1797803317978043-257-247
 OsREG440ACCGGCCC    PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCAGCCCACGAA+1797804617978063-244-227
 OsREG479AGTTGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG591      GCAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG463        AGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG601         GCCCACGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG529          CCCACGAA PPDB MotifGCCCA  PLACE Motif 
REGACTGACAGCCCAGCCCATTA+1797807117978090-219-200
 OsREG453ACTGACAG             PPDB Motif  PLACE MotifTGAC 
 OsREG435    ACAGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG512     CAGCCCAG        PPDB MotifGCCCA  PLACE Motif 
 OsREG464      AGCCCAGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG603       GCCCAGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG533        CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523         CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491          CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432           AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG610            GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.