version
PlantPromoterDB promoter information of J065164O07

Summary of Gene (J065164O07)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0101300        NCBI 
Gene model J065164O07  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 140405-141604)

Genome position     
from initiation codon
013-080-G09         
015-006-A01         
015-044-F09         
AK109515            
AK121897            
J033084O06          
J033105E24          
J033126H24          
J065001F05          
J065002H03          
J065026B12          
J065093E11          
J065122E04          
J065182M16          
J065217N11          
J090002P22          
TSS from cDNA
TSS information
J065164O07                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065164O07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+141318-87

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTC+141290141297-115-108
Y PatchTCTCCCCC+141327141334-78-71
Y PatchTCTCTCTCTCTC+141350141361-55-44
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTTGGGCCTAATTGGGCCTGG+141103141124-302-281
 OsREG479AGTTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC              PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG471  TTGGGCCT  TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG433          AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492           ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG513             TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524              GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGTGGGGGGT+141150141157-255-248
 OsREG438TGGGGGGT PPDB Motif  PLACE Motif 
REGGGCCCCACTTG+141213141223-192-182
 OsREG631GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG498   CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGCACGCCTC+141254141261-151-144
 OsREG503CACGCCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.