version
PlantPromoterDB promoter information of J065165G05

Summary of Gene (J065165G05)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0564000        NCBI 
Gene model J065165G05  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 22272459-22271260)

Genome position     
from initiation codon
AJ486976            
AK073086            
J023060F01          
J033022J16          
J065021E14          
J065099E02          
J065139E02          
J065181H16          
J065217K07          
J065218L13          
J100082K21          
J100084K19          
TSS from cDNA
TSS information
J065165G05                       5'->3' (-)
Promoter sequence










 
006-072-A11         
AK073526            
AK105951            
J075045C12          
J075046E12          
J075052I24          
J075054D22          
J075055E11          
J075063L24          
J075068C05          
J075109F20          
J075154L04          
J100045C15          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065165G05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-22271545-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGATGGGC-2227158522271592-126-133
 OsREG607TGATGGGC PPDB MotifGCCCA  PLACE Motif 
REGGGTGGGGCCCACCTGTC-2227160122271617-142-158
 OsREG612GGTGGGGC          PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC         PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC      PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC     PPDB MotifGCCCA  PLACE Motif 
 OsREG476      GCCCACCT    PPDB MotifGCCCA  PLACE Motif 
 OsREG514       CCCACCTG   PPDB MotifGCCCA  PLACE Motif 
 OsREG436        CCACCTGT  PPDB Motif  PLACE Motif 
 OsREG501         CACCTGTC PPDB Motif  PLACE Motif 
REGGGTCCAGA-2227169422271701-235-242
 OsREG649GGTCCAGA PPDB Motif  PLACE Motif 
REGGGAGTGGG-2227178522271792-326-333
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+22271746AK073526, AK073526, AK105951, 006-072-A11, J100045C15
TSS clone peakAclone+22271757AK073526, AK073526, AK105951, 006-072-A11, J100045C15

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCTCTCT+2227171622271727006-072-A11, AK073526, AK105951, J100045C15
Y PatchTCCTCTCTC+2227173022271738006-072-A11, AK073526, AK105951, J100045C15
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCGTGGGCCAC+2227155522271565006-072-A11, AK073526, AK105951, J100045C15
 OsREG547CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG653   TGGGCCAC PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATCA+2227158422271592006-072-A11, AK073526, AK105951, J100045C15
 OsREG466AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607 GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGACAGGTGGGCCCCACC+2227160122271617006-072-A11, AK073526, AK105951, J100045C15
 OsREG501GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476   AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG628    GGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647      TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641       GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631        GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612         GCCCCACC PPDB Motif  PLACE Motif 
REGTCTGGACC+2227169422271701006-072-A11, AK073526, AK105951, J100045C15
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.