version
PlantPromoterDB promoter information of J065167P13

Summary of Gene (J065167P13)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0252100        NCBI 
Gene model J065167P13  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 8587182-8585983)

Genome position     
from initiation codon
AF139211            
AK062577            
AK099051            
J013067H24          
J013151F04          
J013156E01          
J065001D02          
J065042A05          
J065116H01          
J065168N07          
J075023A15          
J075027M17          
J075065C23          
J075093G21          
J075109H15          
J075194P17          
TSS from cDNA
TSS information
J065167P13                       5'->3' (-)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065167P13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-8587161-979

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCC-85871188587125-936-943
Y PatchCTCCCTCTC-85871678587175-985-993
Y PatchCCTCCTCTCTT-85871948587204-1012-1022
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGCCCACCC-85872068587214-1024-1032
 OsREG462AGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG600 GCCCACCC PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCATTAAAGCCCAGGCCCAAAA-85872168587243-1034-1061
 OsREG645TACGGCCC                     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA                    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT                   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT                  PPDB MotifGCCCA  PLACE Motif 
 OsREG610    GCCCATTA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG421           AAAGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG428            AAGCCCAG         PPDB MotifGCCCA  PLACE Motif 
 OsREG524                CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513                 CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471                  AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625                   GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG592                    GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTATTGGGCCTGA-85872668587277-1084-1095
 OsREG596TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513   TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG646    GGGCCTGA PPDB MotifGCCCA  PLACE Motif 
REGGGACGCGT-85872938587300-1111-1118
 OsREG442GGACGCGT PPDB Motif  PLACE Motif 
REGGGGCCGAGA-85873218587329-1139-1147
 OsREG575GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635 GGCCGAGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.