version
PlantPromoterDB promoter information of J065168P22

Summary of Gene (J065168P22)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0255600        NCBI 
Gene model J065168P22  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 9442759-9443958)

Genome position     
from initiation codon
009-122-B02         
AK073067            
J013021M03          
J033022A04          
J033022B03          
J033116F22          
J065017H13          
J065038G20          
J065076J16          
J065135D06          
J065139F21          
J065188G21          
J065207C14          
J080014C23          
J080018G12          
J080021F03          
J100068C14          
TSS from cDNA
TSS information
J065168P22                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065168P22

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+9443437-322

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAGCTATA+94434019443408-358-351
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCCCCA+94431609443167-599-592
 OsREG482ATCCCCCA PPDB Motif  PLACE Motif 
REGCACGCCAC+94432109443217-549-542
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGATATGGGCTTA+94433119443321-448-438
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG655   TGGGCTTA PPDB MotifGCCCA  PLACE Motif 
REGCTTGGGCTGGGCCCT+94433659443379-394-380
 OsREG459CTTGGGCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG511 TTGGGCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG523  TGGGCTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG533   GGGCTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG579      CTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475       TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCATT+94433869443396-373-363
 OsREG504CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.