version
PlantPromoterDB promoter information of J065169E14

Summary of Gene (J065169E14)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0130500        NCBI 
Gene model J065169E14  
Description Cyclin-like F-box domain containing protein.  
#
#

Overview

Focused view (chromosome 11: 1387816-1386617)

Genome position     
from initiation codon
J065119D16          
TSS from cDNA
TSS information
J065169E14                       5'->3' (-)
Promoter sequence







 
AK066342            
J065192M10          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065169E14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-1387007-191

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCATCTAGGCCCATA-13870471387066-231-250
 OsREG587GAGGCCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT  AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC           PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG656          TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG630            GGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGTA-13870821387093-266-277
 OsREG480ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG645    GGGCCGTA PPDB MotifGCCCA  PLACE Motif 
REGTTTTGGGC-13870981387105-282-289
 OsREG592TTTTGGGC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCTGA-13871071387117-291-301
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG465 TATGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+1387191AK066342, AK066342, J065192M10

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGGGGGATG+13869341386941AK066342, J065192M10
 OsREG516GGGGGATG PPDB Motif  PLACE Motif 
REGTTATGGGCCTAGATGGGCCTC+13870461387066AK066342, J065192M10
 OsREG605TTATGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA           PPDB MotifGCCCA  PLACE Motif 
 OsREG456          AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590           GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG587             TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGTACGGCCCATAT+13870821387093AK066342, J065192M10
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630   GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480    GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGCCCAAAA+13870981387105AK066342, J065192M10
 OsREG592GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCATAT+13871071387117AK066342, J065192M10
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480   GCCCATAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.