version
PlantPromoterDB promoter information of J065170C14

Summary of Gene (J065170C14)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0323900        NCBI 
Gene model J065170C14  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 15023625-15024824)

Genome position     
from initiation codon
006-105-F01         
009-161-D06         
AK070528            
AK104030            
AK104160            
AK119904            
J023060D13          
J033057E10          
J043034F19          
J053099K12          
J065022N03          
J065035G13          
J065059M24          
J065059N23          
J065073I02          
J065095L15          
J065104I24          
J065104J24          
J065112L13          
J065114J24          
J065120J16          
J065141I09          
J065165E17          
J065182I05          
J065191K20          
J065205L14          
J075017M10          
J075019O04          
J075019O15          
J075032E07          
J075042D13          
J075054J07          
J075089O11          
J075104G09          
J075150N03          
J075187A09          
J075187D04          
J090006G06          
J090045C09          
J090083D13          
J090084B13          
J100021H22          
J100034A15          
J100041N15          
J100042D05          
J100042D08          
J100059P21          
L19436              
L34038              
TSS from cDNA
TSS information
J065170C14                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065170C14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+15024564-61
TSS clone peakCclone+15024566-59

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCGCTATATATCGC+1502452815024541-97-84
Y PatchCTCCTCCTCCTCCCCC+1502458015024595-45-30
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGACGGACACGT+1502436315024374-262-251
 OsREG623GGACGGAC     PPDB Motif  PLACE Motif 
 OsREG451    GGACACGT PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCACGCGTCC+1502444315024453-182-172
 OsREG530CCCACGCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG443 CCACGCGT   PPDB Motif  PLACE Motif 
 OsREG442   ACGCGTCC PPDB Motif  PLACE Motif 
REGCGCGACGC+1502448515024492-140-133
 OsREG556CGCGACGC PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.