version
PlantPromoterDB promoter information of J065170E11

Summary of Gene (J065170E11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0908100        NCBI 
Gene model J065170E11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 41297690-41296491)

Genome position     
from initiation codon
AK072293            
J065010B13          
J065010M12          
J065047C19          
J065069B18          
J065071K24          
J065142P04          
J065187C14          
TSS from cDNA
TSS information
J065170E11                       5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065170E11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-41296943-253

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGTCCCAC-4129700441297013-314-323
 OsREG569CGGGTCCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG648 GGGTCCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG650  GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGAGCCGTCC-4129702941297036-339-346
 OsREG468AGCCGTCC PPDB Motif  PLACE Motif 
REGAGTGGGCCCT-4129706841297077-378-387
 OsREG478AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475  TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCACA-4129711041297119-420-429
 OsREG582GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGCTGGGCCGAAATTTCGGCCCAGTA-4129713841297162-448-472
 OsREG620GCTGGGCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG642   GGGCCGAA  TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG634    GGCCGAAATTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG658  TGGGCCGA    TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG      CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG454                GGCCCAGT  PPDB MotifGCCCA  PLACE Motif 
 OsREG604                 GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGTGTTGGGCTTG-4129721141297221-521-531
 OsREG594TGTTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT   PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG426  TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.