version
PlantPromoterDB promoter information of J065173J03

Summary of Gene (J065173J03)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0690300        NCBI 
Gene model J065173J03  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 30018015-30016816)

Genome position     
from initiation codon
012-048-A07         
AK099674            
J013028F12          
J013069F21          
J013104E17          
J013153M16          
J023012L09          
J023069A08          
J023132L23          
J033120P19          
J075008H06          
J075043J15          
J075147I12          
J090041G07          
TSS from cDNA
TSS information
J065173J03                       5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065173J03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-30017474-459

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGGGCCCACGGG-3001751430017527-499-512
 OsREG616GCCGGGCC       PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG566  CGGGCCCA     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640   GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571    GGCCCACG   PPDB MotifGCCCA  PLACE Motif 
 OsREG547     GCCCACGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG531      CCCACGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGCGGGCCCACCTG-3001754930017560-534-545
 OsREG566CGGGCCCA     PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG514    CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGAGCCCAATT-3001756930017577-554-562
 OsREG460AGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433 GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCACA-3001759130017600-576-585
 OsREG435ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.