version
PlantPromoterDB promoter information of J065175G24

Summary of Gene (J065175G24)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0473900        NCBI 
Gene model J065175G24  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 23428455-23429654)

Genome position     
from initiation codon
012-010-C04         
012-025-A10         
012-025-C03         
012-030-H02         
012-033-A03         
012-044-F02         
012-050-C04         
012-051-G08         
012-051-H03         
012-056-F12         
012-062-E07         
012-067-C12         
012-073-B07         
012-078-H09         
012-083-G12         
012-086-C12         
012-089-H12         
012-091-B09         
012-092-G08         
014-045-D08         
015-004-H02         
015-005-G05         
015-007-D06         
015-014-G04         
015-019-G11         
015-037-G04         
015-044-D02         
015-046-A05         
015-049-D09         
015-052-F12         
015-054-E03         
015-066-D02         
015-070-H03         
015-074-H10         
015-077-C04         
015-090-A10         
015-091-F11         
016-002-G04         
016-004-E03         
016-015-G12         
016-018-G01         
016-023-C07         
016-023-G06         
016-027-G04         
016-039-G04         
016-044-A06         
016-053-H06         
016-057-G08         
016-063-H03         
016-066-A01         
016-066-E08         
016-072-G03         
016-074-A10         
016-088-C06         
016-090-D01         
AK073487            
AK119561            
AK119761            
J033024B15          
J033040A17          
J033041J03          
J033093F11          
J033117E15          
J033128F11          
J065006O09          
J065010E21          
J065011P15          
J065013M15          
J065019E20          
J065021I21          
J065022D23          
J065024L10          
J065026P16          
J065027C20          
J065027G06          
J065027G23          
J065028B11          
J065030J05          
J065031G17          
J065034J07          
J065037N01          
J065040H20          
J065041C22          
J065044A21          
J065044L06          
J065045J02          
J065048D10          
J065049H23          
J065049I21          
J065052D03          
J065055D22          
J065057L13          
J065058B13          
J065059B04          
J065059C05          
J065059H01          
J065059K01          
J065063G19          
J065073E20          
J065075I10          
J065081I24          
J065084E05          
J065084E12          
J065084J12          
J065086H18          
J065087F07          
J065095J02          
J065097E24          
J065102I06          
J065104N21          
J065105A16          
J065107C13          
J065108N11          
J065112I04          
J065112J05          
J065112K17          
J065115I05          
J065120J21          
J065120K18          
J065121L19          
J065123K20          
J065123M10          
J065124L18          
J065127E19          
J065128B05          
J065130F11          
J065130P06          
J065132K13          
J065134I17          
J065139I11          
J065141G14          
J065141O04          
J065146P07          
J065148L24          
J065154H20          
J065155I05          
J065165F05          
J065166I20          
J065168D14          
J065168F12          
J065169F17          
J065169J11          
J065169O14          
J065171E05          
J065171L21          
J065178M19          
J065179C17          
J065179E04          
J065180C03          
J065182D08          
J065183P17          
J065188N09          
J065190N03          
J065191H11          
J065193C13          
J065193G19          
J065199F19          
J065202L20          
J065204K12          
J065206H08          
J065208E02          
J065210O09          
J065211L19          
J065211N19          
J065212I06          
J065213P21          
J065215C14          
J100032J03          
M24287              
TSS from cDNA
TSS information
J065175G24                       5'->3' (+)
Promoter sequence



 
015-065-A07         
AK064124            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065175G24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+23429295-160
TSS clone peakAclone+23429363-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATATATG+2342932823429337-127-118
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGGCCCC+2342919423429203-261-252
 OsREG441ACCGGGCC   PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC PPDB MotifACGGGC  PLACE Motif 
REGTCCACGCC+2342925523429262-200-193
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.