version
PlantPromoterDB promoter information of J065180A21

Summary of Gene (J065180A21)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0663400        NCBI 
Gene model J065180A21  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 28848661-28847462)

Genome position     
from initiation codon
016-054-B01         
AK072283            
J075026E13          
J075109M23          
J075151A02          
J090004B07          
J100057F11          
TSS from cDNA
TSS information
J065180A21                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065180A21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-28848083-422

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCGCTATAAATT-2884811028848121-449-460
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGATCGGACGGC-2884814928848159-488-498
 OsREG589GATCGGAC    PPDB Motif  PLACE Motif 
 OsREG484 ATCGGACG   PPDB Motif  PLACE Motif 
 OsREG545  TCGGACGG  PPDB Motif  PLACE Motif 
 OsREG562   CGGACGGC PPDB Motif  PLACE Motif 
REGGCCGTTGG-2884816328848170-502-509
 OsREG518GCCGTTGG PPDB MotifCCAACGG  PLACE Motif 
REGCCGATCCGACGG-2884818128848192-520-531
 OsREG541CCGATCCG     PPDB Motif  PLACE Motif 
 OsREG588  GATCCGAC   PPDB MotifCCGAC  PLACE Motif 
 OsREG483   ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546    TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCACCTGTC-2884820528848212-544-551
 OsREG501CACCTGTC PPDB Motif  PLACE Motif 
REGCAAGCCCAG-2884828228848290-621-629
 OsREG496CAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCTCGCGCG-2884747728847484AK072645, J090023O22, J090054G09, J090058H13, J090076G13
 OsREG558CTCGCGCG PPDB MotifACGCGC  PLACE Motif 
REGCGCGACGCG-2884764628847654AK072645, J090023O22, J090054G09, J090058H13, J090076G13
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.