version
PlantPromoterDB promoter information of J065180C08

Summary of Gene (J065180C08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0102600        NCBI 
Gene model J065180C08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 143645-144844)

Genome position     
from initiation codon
AK064812            
J013000E05          
J013027D08          
J013045K12          
J023119M03          
J065081F02          
J065211M06          
J075073J06          
J075123A18          
J075124A07          
J075187B05          
TSS from cDNA
TSS information
J065180C08                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065180C08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+144603-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCATCCA+144304144311-341-334
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCACGTGGGGCCCGCA+144457144471-188-174
 OsREG508CACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG450 ACGTGGGG       PPDB MotifACGT  PLACE Motif 
 OsREG572  CGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631   GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641    TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567     GGGGCCCG   PPDB MotifACGGGC  PLACE Motif 
 OsREG619      GGGCCCGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG632       GGCCCGCA PPDB Motif  PLACE Motif 
REGGGTGGGACCCAC+144522144533-123-112
 OsREG651GGTGGGAC     PPDB MotifGGGACCC  PLACE Motif 
 OsREG650 GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648  TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637   GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622    GGACCCAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.