version
PlantPromoterDB promoter information of J065184G15

Summary of Gene (J065184G15)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0103700        NCBI 
Gene model J065184G15  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 184355-183156)

Genome position     
from initiation codon
006-046-H11         
006-060-B05         
006-097-A09         
006-102-A10         
006-104-E11         
006-112-D09         
009-031-C12         
AK061774            
AK062502            
AK065309            
AK102186            
AK106213            
J013002O13          
J013026F06          
J013037O14          
J013066N06          
J013108G22          
J023050M15          
J023054B21          
J023073C23          
J023086H17          
J023105A20          
J033086N17          
J065019E16          
J065064G10          
J065071C18          
J065103B02          
J065153G06          
J065161I07          
J075123E02          
J075152G24          
J075166P04          
J080001F02          
J080001M07          
J080001O05          
J080003I19          
J080004C12          
J080008E17          
J080008M08          
J080010H21          
J080011F22          
J080012C16          
J080013D20          
J080018K15          
J080020O14          
J080020P21          
J080021A07          
J080021B06          
J080022G21          
J080022P14          
J080023H24          
J080023M08          
J080027E08          
J080027E18          
J080027O16          
J080029M22          
J080034A17          
J080038G04          
J080040F13          
J080040F22          
J080041L15          
J080042L04          
J080042M14          
J080043C22          
J080043O09          
J080045N17          
J080046N08          
J080047K11          
J080047O06          
J080048H10          
J080048N03          
J080050N02          
J080051A05          
J080052I20          
J080053E08          
J080055P05          
J080056F15          
J080056H07          
J080057M20          
J080059K09          
J080059M10          
J080060B12          
J080061N09          
J080062H11          
J080062M13          
J080063D14          
J080063G10          
J080063H18          
J080066J23          
J080067J06          
J080069I11          
J080069O22          
J080070P11          
J080072D06          
J080072J22          
J080075A20          
J080076F11          
J080076J24          
J080076K05          
J080077O10          
J080078L19          
J080080I08          
J080081J23          
J080083A17          
J080085C05          
J080086G24          
J080087H02          
J080089A13          
J080090K08          
J080092M01          
J080095A19          
J080095B20          
J100028F13          
J100040G22          
TSS from cDNA
TSS information
J065184G15                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065184G15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-183440-85
TSS clone peakCclone-183436-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCACCTATATAAAG-183464183476-109-121
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGCCCAATA-183508183518-153-163
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGAACGGCCCACCA-183526183537-171-182
 OsREG423AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599    GCCCACCA PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCCCATCCA-183547183560-192-205
 OsREG492ATTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG639 TTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489   GGGCCCAT    PPDB MotifGCCCA  PLACE Motif 
 OsREG590    GGCCCATC   PPDB MotifGCCCA  PLACE Motif 
 OsREG608     GCCCATCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG534      CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCTGGGCTGC-183593183601-238-246
 OsREG512CTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591 TGGGCTGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.