version
PlantPromoterDB promoter information of J065186A03

Summary of Gene (J065186A03)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0433200        NCBI 
Gene model J065186A03  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 21098070-21099269)

Genome position     
from initiation codon
                    
013-023-E07         
AK099471            
J013024A05          
J013065N03          
J023111A21          
J065035F10          
J065083H01          
J065159E03          
J075032B02          
J075038L14          
J075041J12          
J075047N21          
J075076H05          
J075110C08          
J090096K17          
Os08g0433150        
TSS from cDNA
TSS information
J065186A03                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065186A03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+21098742-878

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCCCC+2109875621098763-864-857
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCAGC+2109852221098531-1098-1089
 OsREG430AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCCTA+2109855021098559-1070-1061
 OsREG517CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474 ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGCATGGGCCTA+2109857821098587-1042-1033
 OsREG517CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474 ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAAAC+2109860321098613-1017-1007
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTATGGGCCGAAA+2109862821098639-992-981
 OsREG630TATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490 ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642   GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634    GGCCGAAA PPDB Motif  PLACE Motif 
REGTACGGCCCGGCCCAAA+2109864421098659-976-961
 OsREG645TACGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG        PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG       PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538     CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542      CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563       CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625        GGCCCAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.