version
PlantPromoterDB promoter information of J065186A16

Summary of Gene (J065186A16)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0288900        NCBI 
Gene model J065186A16  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 10049398-10050597)

Genome position     
from initiation codon
AK072700            
AK100329            
J013132H07          
J023080H15          
J023135G07          
J033136I21          
J065036A16          
J065067O03          
J065087F15          
J065171I20          
J065187B08          
J065202E24          
TSS from cDNA
TSS information
J065186A16                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065186A16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+10050301-97

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCCC+1005025510050262-143-136
Y PatchCCCTCCCCC+1005030910050317-89-81
Y PatchTTCCTCCC+1005032110050328-77-70
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCAGAT+1005012310050133-275-265
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486   GCCCAGAT PPDB MotifGCCCA  PLACE Motif 
REGAGCCCATT+1005014210050149-256-249
 OsREG432AGCCCATT PPDB MotifGCCCA  PLACE Motif 
REGGGCCCGGCCCACC+1005016210050174-236-224
 OsREG616GGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564    CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG628     GGCCCACC PPDB MotifGCCCA  PLACE Motif 
REGCCAACGGC+1005023710050244-161-154
 OsREG518CCAACGGC PPDB MotifCCAACGG  PLACE Motif 
REGCTCCCCCA+1005024710050254-151-144
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.