version
PlantPromoterDB promoter information of J065186D05

Summary of Gene (J065186D05)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0101400        NCBI 
Gene model J065186D05  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 78763-77564)

Genome position     
from initiation codon
009-126-G06         
AK067481            
J065124O10          
J065193A14          
J075082A02          
J075100F11          
J075111O16          
J075172I24          
TSS from cDNA
TSS information
J065186D05                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J065186D05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-77830-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCCCC-7788877898-125-135
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCTTGGGCCGC-7792077936-157-173
 OsREG479AGTTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG426  TTGGGCTT        PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG519    GGGCTTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG581       CTTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG563        TTGGGCCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG618         TGGGCCGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.